Subsequences
In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle A,B,D \rangle} is a subsequence of Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle A,B,C,D,E,F \rangle} obtained after removal of elements Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle C,} Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle E,} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle F.} The relation of one sequence being the subsequence of another is a preorder.
Subsequences can contain consecutive elements which were not consecutive in the original sequence. A subsequence which consists of a consecutive run of elements from the original sequence, such as Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle B,C,D \rangle,} from Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle A,B,C,D,E,F \rangle,} is a substring. The substring is a refinement of the subsequence.
The list of all subsequences for the word "apple" would be "a", "ap", "al", "ae", "app", "apl", "ape", "ale", "appl", "appe", "aple", "apple", "p", "pp", "pl", "pe", "ppl", "ppe", "ple", "pple", "l", "le", "e", "" (empty string).
Common subsequence
Given two sequences Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y,} a sequence Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Z} is said to be a common subsequence of Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y,} if Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Z} is a subsequence of both Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y.} For example, if Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X = \langle A,C,B,D,E,G,C,E,D,B,G \rangle \qquad \text{ and}} Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y = \langle B,E,G,J,C,F,E,K,B \rangle \qquad \text{ and}} Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Z = \langle B,E,E \rangle.} then Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Z} is said to be a common subsequence of Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y.}
This would not be the longest common subsequence, since Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Z} only has length 3, and the common subsequence Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle B,E,E,B \rangle} has length 4. The longest common subsequence of Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle X} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle Y} is Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \langle B,E,G,C,E,B \rangle.}
Applications
Subsequences have applications to computer science, especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences.
Take two sequences of DNA containing 37 elements, say:
- SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
- SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
The longest common subsequence of sequences 1 and 2 is:
- LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA
This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:
- SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
- SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
Another way to show this is to align the two sequences, that is, to position elements of the longest common subsequence in a same column (indicated by the vertical bar) and to introduce a special character (here, a dash) for padding of arisen empty subsequences:
- SEQ1 = ACGGTGTCGTGCTAT-G--C-TGATGCTGA--CT-T-ATATG-CTA-
- | || ||| ||||| | | | | || | || | || | |||
- SEQ2 = -C-GT-TCG-GCTATCGTACGT--T-CT-ATTCTATGAT-T-TCTAA
Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.
Theorems
- Every infinite sequence of real numbers has an infinite monotone subsequence (This is a lemma used in the proof of the Bolzano–Weierstrass theorem).
- Every infinite bounded sequence in Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle \R^n} has a convergent subsequence (This is the Bolzano–Weierstrass theorem).
- For all integers Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle r} and Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle s,} every finite sequence of length at least Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle (r - 1)(s - 1) + 1} contains a monotonically increasing subsequence of length Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle r} or a monotonically decreasing subsequence of length Failed to parse (MathML with SVG or PNG fallback (recommended for modern browsers and accessibility tools): Invalid response ("Math extension cannot connect to Restbase.") from server "https://wikimedia.org/api/rest_v1/":): {\displaystyle s} (This is the Erdős–Szekeres theorem).
Licensing
Content obtained and/or adapted from:
- Subsequence, Wikipedia under a CC BY-SA license